ID: 1005295729_1005295739

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1005295729 1005295739
Species Human (GRCh38) Human (GRCh38)
Location 6:24424942-24424964 6:24424987-24425009
Sequence CCCACTCCTGTGTGTGGTCATGG AGAACAGAATGGAACAGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 194} {0: 1, 1: 2, 2: 60, 3: 198, 4: 751}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!