ID: 1005312024_1005312031

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1005312024 1005312031
Species Human (GRCh38) Human (GRCh38)
Location 6:24567898-24567920 6:24567944-24567966
Sequence CCTCCCAATTTCCCCTTAGAAAC ATTCTCTCTACTTTTATGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 200} {0: 1, 1: 0, 2: 2, 3: 21, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!