ID: 1005327299_1005327307

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1005327299 1005327307
Species Human (GRCh38) Human (GRCh38)
Location 6:24715260-24715282 6:24715280-24715302
Sequence CCAGCATTCTCCCCAAGTAACTG CTGTGGGGATCTCTTGGTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 170} {0: 1, 1: 0, 2: 0, 3: 7, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!