ID: 1005347629_1005347630

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1005347629 1005347630
Species Human (GRCh38) Human (GRCh38)
Location 6:24905993-24906015 6:24906034-24906056
Sequence CCAAAAGTGAAGAGGCAAATACA CTGTTGTTTTTCAGTACATAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 31, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!