ID: 1005349911_1005349914

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1005349911 1005349914
Species Human (GRCh38) Human (GRCh38)
Location 6:24924013-24924035 6:24924061-24924083
Sequence CCTGTCGTGTCTGTTTTGAAAAG CAGGCTGAGCAGACCCACGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!