ID: 1005360197_1005360207

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1005360197 1005360207
Species Human (GRCh38) Human (GRCh38)
Location 6:25024127-25024149 6:25024164-25024186
Sequence CCTTACCGGTGGCGCCGCGGGAC GGCGATTTCCACTTGTTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 28} {0: 3, 1: 3, 2: 4, 3: 7, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!