ID: 1005397574_1005397581

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1005397574 1005397581
Species Human (GRCh38) Human (GRCh38)
Location 6:25399060-25399082 6:25399109-25399131
Sequence CCCCGCTCACAGATGGTTCAAAA GTGGAGAGAAGGCCTCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 103} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!