ID: 1005421379_1005421382

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1005421379 1005421382
Species Human (GRCh38) Human (GRCh38)
Location 6:25654922-25654944 6:25654941-25654963
Sequence CCTTCATTCTTGTACCTACACAA ACAAGCTACAGGTAGAGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 218} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!