ID: 1005437357_1005437362

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1005437357 1005437362
Species Human (GRCh38) Human (GRCh38)
Location 6:25829105-25829127 6:25829150-25829172
Sequence CCTCAAAACATAAGTTGGGCCTT ACTTTTGATCTTGGGATTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 131} {0: 1, 1: 0, 2: 7, 3: 71, 4: 523}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!