ID: 1005456722_1005456730

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1005456722 1005456730
Species Human (GRCh38) Human (GRCh38)
Location 6:26027107-26027129 6:26027134-26027156
Sequence CCGGAAATTCGCTTAACCCCACC CTAGCAAGGCGCCGAATGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 50} {0: 1, 1: 1, 2: 3, 3: 5, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!