ID: 1005464941_1005464945

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1005464941 1005464945
Species Human (GRCh38) Human (GRCh38)
Location 6:26103835-26103857 6:26103887-26103909
Sequence CCAAATTTGAAAAAAAAAAAAAA GTCCGCCAAGTTTGTATTTAAGG
Strand - +
Off-target summary {0: 6, 1: 92, 2: 1251, 3: 11973, 4: 73434} {0: 1, 1: 0, 2: 1, 3: 3, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!