ID: 1005470267_1005470273

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1005470267 1005470273
Species Human (GRCh38) Human (GRCh38)
Location 6:26156416-26156438 6:26156438-26156460
Sequence CCGCTGCTCCGGCCCCTGCCGAG GAAGACTCCCGTGAAGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 427} {0: 1, 1: 0, 2: 1, 3: 15, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!