ID: 1005475608_1005475613

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1005475608 1005475613
Species Human (GRCh38) Human (GRCh38)
Location 6:26204725-26204747 6:26204747-26204769
Sequence CCAGGGCATTACCAAGCCTGCCA ATCCGGCGCCTTGCTCGTCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 7, 4: 165} {0: 2, 1: 2, 2: 1, 3: 2, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!