ID: 1005475610_1005475620

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1005475610 1005475620
Species Human (GRCh38) Human (GRCh38)
Location 6:26204736-26204758 6:26204782-26204804
Sequence CCAAGCCTGCCATCCGGCGCCTT CATTTCTGGTCTCATCTACGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 9, 4: 115} {0: 2, 1: 0, 2: 2, 3: 17, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!