ID: 1005475612_1005475622

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1005475612 1005475622
Species Human (GRCh38) Human (GRCh38)
Location 6:26204745-26204767 6:26204793-26204815
Sequence CCATCCGGCGCCTTGCTCGTCGC TCATCTACGAGGAGACTCGCGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 0, 4: 43} {0: 3, 1: 1, 2: 0, 3: 3, 4: 19}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!