ID: 1005475615_1005475621

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1005475615 1005475621
Species Human (GRCh38) Human (GRCh38)
Location 6:26204749-26204771 6:26204792-26204814
Sequence CCGGCGCCTTGCTCGTCGCGGGG CTCATCTACGAGGAGACTCGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 3, 4: 44} {0: 3, 1: 2, 2: 5, 3: 3, 4: 36}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!