ID: 1005479315_1005479324

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1005479315 1005479324
Species Human (GRCh38) Human (GRCh38)
Location 6:26240522-26240544 6:26240549-26240571
Sequence CCCGCCATCCGTCGCTTGGCCCG GGCGGCGTGAAACGCATTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 53} {0: 1, 1: 1, 2: 2, 3: 3, 4: 22}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!