ID: 1005482987_1005483002

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1005482987 1005483002
Species Human (GRCh38) Human (GRCh38)
Location 6:26272393-26272415 6:26272438-26272460
Sequence CCGCCTCCAGGTACACCGGCGCA AGTTGCCCTTGCGGAGGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 6, 4: 74} {0: 1, 1: 2, 2: 5, 3: 15, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!