ID: 1005484323_1005484327

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1005484323 1005484327
Species Human (GRCh38) Human (GRCh38)
Location 6:26285340-26285362 6:26285373-26285395
Sequence CCTCATAGATAAGGCCAGAAATT CGCCGCGACGAGCAAGGCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 205} {0: 1, 1: 3, 2: 0, 3: 11, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!