ID: 1005500771_1005500777

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1005500771 1005500777
Species Human (GRCh38) Human (GRCh38)
Location 6:26427246-26427268 6:26427263-26427285
Sequence CCAGCTACAGGAAGAGCATATGC ATATGCAAAGGGCCTGGGGAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 107} {0: 2, 1: 2, 2: 17, 3: 157, 4: 947}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!