ID: 1005505049_1005505056

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1005505049 1005505056
Species Human (GRCh38) Human (GRCh38)
Location 6:26462380-26462402 6:26462420-26462442
Sequence CCCAGCCTGGGCAACATGTTAGC GCCTGTAATCCTAGCTAGTTGGG
Strand - +
Off-target summary No data {0: 15, 1: 2086, 2: 47545, 3: 203024, 4: 531462}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!