ID: 1005505474_1005505479

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1005505474 1005505479
Species Human (GRCh38) Human (GRCh38)
Location 6:26465574-26465596 6:26465604-26465626
Sequence CCACCATAGAAAGGACACAGCTC TACCAGCATACAGAAGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 140} {0: 2, 1: 0, 2: 0, 3: 10, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!