ID: 1005505475_1005505481

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1005505475 1005505481
Species Human (GRCh38) Human (GRCh38)
Location 6:26465577-26465599 6:26465625-26465647
Sequence CCATAGAAAGGACACAGCTCTCC GGAAATGCACAGCAGCAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 172} {0: 1, 1: 0, 2: 6, 3: 39, 4: 421}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!