ID: 1005522833_1005522841

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1005522833 1005522841
Species Human (GRCh38) Human (GRCh38)
Location 6:26614878-26614900 6:26614920-26614942
Sequence CCAAGGATGGGAGGGAAGTTATC TTTAGAATTCACTGGGGAGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!