ID: 1005527498_1005527505

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1005527498 1005527505
Species Human (GRCh38) Human (GRCh38)
Location 6:26665321-26665343 6:26665361-26665383
Sequence CCCTCCACCATCTGTGGAAAATT GTCCCTGGTGCCAAAATGGTTGG
Strand - +
Off-target summary No data {0: 46, 1: 1018, 2: 1746, 3: 1420, 4: 1010}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!