ID: 1005569805_1005569811

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1005569805 1005569811
Species Human (GRCh38) Human (GRCh38)
Location 6:27133805-27133827 6:27133841-27133863
Sequence CCAAAAGAGTTATCGCCCGGGCT CAGCTGTTCCACGCGGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 13} {0: 1, 1: 0, 2: 0, 3: 7, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!