ID: 1005570359_1005570361

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1005570359 1005570361
Species Human (GRCh38) Human (GRCh38)
Location 6:27139419-27139441 6:27139432-27139454
Sequence CCTTGCTCGCCGCGGCGGCGTGA GGCGGCGTGAAGCGCATTTCTGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 5, 4: 50} {0: 1, 1: 3, 2: 3, 3: 7, 4: 15}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!