ID: 1005582457_1005582462

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1005582457 1005582462
Species Human (GRCh38) Human (GRCh38)
Location 6:27247898-27247920 6:27247926-27247948
Sequence CCTGGGTGAGCACATTCAGCAGT GAGAGCTCTGCCCAGGGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 108} {0: 1, 1: 0, 2: 1, 3: 54, 4: 460}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!