ID: 1005583210_1005583216

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1005583210 1005583216
Species Human (GRCh38) Human (GRCh38)
Location 6:27252051-27252073 6:27252093-27252115
Sequence CCTGGCACAGCTGGGAGGAGTTA CCACTTCCGTTGTGTGATCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 206} {0: 1, 1: 0, 2: 3, 3: 14, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!