ID: 1005632216_1005632219

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1005632216 1005632219
Species Human (GRCh38) Human (GRCh38)
Location 6:27719051-27719073 6:27719091-27719113
Sequence CCCAAGACTGGGTAATTCATAAA GACTCACAGTTCCACGTGACTGG
Strand - +
Off-target summary {0: 60, 1: 2867, 2: 11043, 3: 14624, 4: 13237} {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!