ID: 1005632217_1005632219

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1005632217 1005632219
Species Human (GRCh38) Human (GRCh38)
Location 6:27719052-27719074 6:27719091-27719113
Sequence CCAAGACTGGGTAATTCATAAAG GACTCACAGTTCCACGTGACTGG
Strand - +
Off-target summary {0: 84, 1: 3592, 2: 4506, 3: 3287, 4: 3158} {0: 36, 1: 862, 2: 5111, 3: 8006, 4: 8083}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!