ID: 1005639408_1005639410

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1005639408 1005639410
Species Human (GRCh38) Human (GRCh38)
Location 6:27781807-27781829 6:27781832-27781854
Sequence CCTTCACTCTTCTAAAAAGGCAT TTTGTTAGGTCCTTTTTCCATGG
Strand - +
Off-target summary No data {0: 39, 1: 40, 2: 27, 3: 29, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!