ID: 1005643990_1005644000

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1005643990 1005644000
Species Human (GRCh38) Human (GRCh38)
Location 6:27824229-27824251 6:27824274-27824296
Sequence CCGGCGCCTTGCTCGCCGCGGCG CATCTACGAGGAGACTCGCGGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 4, 3: 11, 4: 102} {0: 3, 1: 1, 2: 0, 3: 2, 4: 25}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!