ID: 1005668538_1005668545

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1005668538 1005668545
Species Human (GRCh38) Human (GRCh38)
Location 6:28081378-28081400 6:28081403-28081425
Sequence CCTGCTTCCCTTGGGAAGAGTAA GCCGTTTTGTAGGACACTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 182} {0: 1, 1: 0, 2: 0, 3: 2, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!