ID: 1005670876_1005670883

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1005670876 1005670883
Species Human (GRCh38) Human (GRCh38)
Location 6:28105005-28105027 6:28105028-28105050
Sequence CCGCGGGGTTGCCCTAGCCAACC GGAGCCCAGCTCCCCCACGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!