ID: 1005691611_1005691614

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1005691611 1005691614
Species Human (GRCh38) Human (GRCh38)
Location 6:28311984-28312006 6:28312004-28312026
Sequence CCAAGTAAAGTCAAATCCTTCTC CTCTTGTGATTTGGACCTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 20, 3: 46, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!