ID: 1005696130_1005696134

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1005696130 1005696134
Species Human (GRCh38) Human (GRCh38)
Location 6:28354442-28354464 6:28354465-28354487
Sequence CCCAATATATAGGTTTGGCACAC AGGCCTGACATATAAACTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98} {0: 3, 1: 2, 2: 4, 3: 18, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!