ID: 1005696135_1005696141

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1005696135 1005696141
Species Human (GRCh38) Human (GRCh38)
Location 6:28354468-28354490 6:28354514-28354536
Sequence CCTGACATATAAACTTTGGGCAC GACACATAAGTCTGACACATAGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 7, 3: 13, 4: 103} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!