ID: 1005699844_1005699846

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1005699844 1005699846
Species Human (GRCh38) Human (GRCh38)
Location 6:28389399-28389421 6:28389415-28389437
Sequence CCTTGTGCTAAAAGTCTGCAGTG TGCAGTGGCCTTTAGTTTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 173} {0: 1, 1: 0, 2: 1, 3: 11, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!