ID: 1005710984_1005710992

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1005710984 1005710992
Species Human (GRCh38) Human (GRCh38)
Location 6:28502583-28502605 6:28502618-28502640
Sequence CCCTCTGCTCGGCCGCCACGCCG ACCCAACAGCTCATTGAGAACGG
Strand - +
Off-target summary No data {0: 1045, 1: 721, 2: 149, 3: 73, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!