ID: 1005716804_1005716810

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1005716804 1005716810
Species Human (GRCh38) Human (GRCh38)
Location 6:28557246-28557268 6:28557297-28557319
Sequence CCAATACAAATGGGAGTGGCATT AGCATGACATGGAAGATTTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 18, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!