ID: 1005753999_1005754006

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1005753999 1005754006
Species Human (GRCh38) Human (GRCh38)
Location 6:28909423-28909445 6:28909436-28909458
Sequence CCCAATTCCATGACCTTCCAGGA CCTTCCAGGAACTAGGACAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 216} {0: 1, 1: 0, 2: 5, 3: 21, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!