ID: 1005758861_1005758870

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1005758861 1005758870
Species Human (GRCh38) Human (GRCh38)
Location 6:28949880-28949902 6:28949923-28949945
Sequence CCCACGGAGGCGGGGGAAGGCTC CCGAAGCCTGCCCCGCGGGAAGG
Strand - +
Off-target summary {0: 45, 1: 48, 2: 29, 3: 145, 4: 405} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!