ID: 1005786213_1005786219

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1005786213 1005786219
Species Human (GRCh38) Human (GRCh38)
Location 6:29248303-29248325 6:29248334-29248356
Sequence CCTTAAGGAGGGCCTTTGTTAGG GATAATGGAAGAGCCTTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 3, 3: 15, 4: 99} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!