ID: 1005816651_1005816663

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1005816651 1005816663
Species Human (GRCh38) Human (GRCh38)
Location 6:29558585-29558607 6:29558631-29558653
Sequence CCATCCACCACTGCCGTTTGCCA TCCATCCCTCGGATCTGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 44, 2: 81, 3: 103, 4: 231} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!