ID: 1005822204_1005822211

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1005822204 1005822211
Species Human (GRCh38) Human (GRCh38)
Location 6:29607292-29607314 6:29607321-29607343
Sequence CCTAAGGGAGAGTGGGCAGGGAG CAGGGAGCTCATGGTGGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 48, 4: 461} {0: 1, 1: 0, 2: 2, 3: 23, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!