ID: 1005831233_1005831244

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1005831233 1005831244
Species Human (GRCh38) Human (GRCh38)
Location 6:29672730-29672752 6:29672762-29672784
Sequence CCCTCCAGTGATCCATAAGGCCC CCAAAGGAGAGGTCACAGATAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 120} {0: 1, 1: 0, 2: 2, 3: 24, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!