ID: 1005852504_1005852508

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1005852504 1005852508
Species Human (GRCh38) Human (GRCh38)
Location 6:29832129-29832151 6:29832149-29832171
Sequence CCTGAGTCTACATTAATAAAGAT GATATTGCCTTTAGAATAGGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 241} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!