ID: 1005875211_1005875216

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1005875211 1005875216
Species Human (GRCh38) Human (GRCh38)
Location 6:30006260-30006282 6:30006288-30006310
Sequence CCAAGACTCAGGGAACATTGAGA CGTTTGTCACAGGAGGAGCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 2, 4: 80}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!