ID: 1005882915_1005882933

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1005882915 1005882933
Species Human (GRCh38) Human (GRCh38)
Location 6:30074354-30074376 6:30074404-30074426
Sequence CCCAGACGCCCAGGGGTCGGTCG AAGGAGCCGGGGCCCAGGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 35} {0: 1, 1: 1, 2: 6, 3: 48, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!